Overview

When you publish manuscripts based on data generated at our facility, we would greatly appreciate an acknowledgement of our efforts. Please cite our facility as follows (for example):

Basic processing of the raw data were performed by the University of Illinois at Chicago Research Informatics Core (UICRIC).

We adhere to a general policy for acknowledgements and authorship as established by the Association for Biomolecular Resource Facilities (ABRF) , and we support the following statement from the ABRF.

The existence of core facilities depends in part on proper acknowledgment in publications. This is an important metric of the value of most core facilities. Proper acknowledgment of core facilities enables them to obtain financial and other support so that they may continue to provide their essential services in the best ways possible. It also helps core personnel to advance in their careers, adding to the overall health of the core facility.

Please contact us for assistance in drafting manuscripts.

Output Files

File Description Type
example.gene-AA.fa Protein sequences of predicted ORFs for example result
example.gene-NT.fa Nucleotide sequences of predicted ORFs for example result
example.annotation.txt Annotations of predicted ORFs for example result
example.gff Details of predicted ORFs for example in GFF format result
example.gbk Annotated sequences of contigs for example result
example.raw_assembly.zip ZIP compressed FASTA file of all contigs and scaffolds for example result
example.assembly.zip ZIP compressed FASTA file of filtered contigs and scaffolds for example result
Name OriginalID
example example

Details

Method: cutadapt

Sequencing trimming using cutadapt

Custom Parameters
  • --report = minimal
  • -m = 70
  • --trim-n
  • --max-n = 1
  • -q = 10
  • -b = file:/mnt/store3/clustcrilab/reference/other/primers.fa
Method: Quality trimming

Quality trimming based on quality threshold and length parameters.

Custom Parameters
  • p = 10
  • min length = 70
Method: Adapter trimming

Adapter/primer sequences were trimmed from the reads.

Custom Parameters
  • adapter = TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
  • adapter = GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG
  • adapter = CAAGCAGAAGACGGCATACGAGAT
  • adapter = AATGATACGGCGACCACCGAGATCTACAC
  • adapter = AATGATACGGCGACCACCGAGATCTACACGTAAGGAGTCGTCGGCAGCGTC
  • adapter = CAGTTACGTATTGC
  • adapter = CGTTCTGTTTATGTTTCTTG
Method: Abiguous nucleotide trimming

Ambiguous nucleotides (N) were trimmed from the ends and reads with internal ambiguous nucleotides were discarded.

Custom Parameters
  • max-n = 1

FiguresReturn to top

Figure 1. Trimming results

TablesReturn to top

Table 1. Trimming statistics Download table data

Sample Trim passed Ambig dropped Trim filter dropped Trim length dropped Percent passed Mean Length Mean Trimmed Length Quality trimmed bp
example 9504850 708 0 138755 98.55% 292.6 NA 258766

  • Denovo genome assembly using short read sequence data

  • Figures
  • Tables

Details

Method: SPAdes assembler

SPAdes - St. Petersburg genome assembler is an assembly toolkit containing various denovo genome assembly pipelines.

Custom Parameters
  • -k = 27,47,67,87,107,127

FiguresReturn to top

Figure 1. Coverage plot for example

TablesReturn to top

Table 1. Assembly summary for all samples Download table data

Sample Count TotalLength Longest N50 N75 N90 L50 L75 L90
example 119 1789508 182623 98522 42066 18670 7 14 24

Table 2. Scaffold summary for all samples Download table data

Sample Count TotalLength Longest N50 N75 N90 L50 L75 L90
example 119 1789508 182623 98522 42066 18670 7 14 24

Table 3. Basic contig statistics for example Download table data

#ID length GC coverage C50 C75 C90 S_2mer S_3mer S_4mer
NODE_1 182623 33.467 684.59 646.00 371.00 181.00 0.956 0.954 0.952
NODE_2 178351 34.587 1253.42 1237.00 765.00 442.00 0.959 0.956 0.953
NODE_3 168600 34.098 1914.56 1841.00 1159.00 613.00 0.958 0.955 0.953
NODE_4 108610 33.987 1071.17 1032.00 588.00 305.00 0.955 0.953 0.950
NODE_5 106404 34.917 2697.86 2140.00 1271.00 705.00 0.963 0.961 0.958
NODE_6 104422 34.860 1578.88 1564.00 872.00 468.00 0.961 0.958 0.955
NODE_7 98522 34.342 1482.21 1444.00 816.00 445.00 0.958 0.956 0.954
NODE_8 92742 35.171 1287.58 1280.00 807.00 467.00 0.962 0.959 0.956
NODE_9 70410 34.789 1079.93 1066.00 675.00 382.00 0.959 0.956 0.952
NODE_10 57454 34.495 788.26 782.00 472.00 271.00 0.958 0.955 0.952
NODE_11 56714 33.849 1357.29 1297.00 751.00 411.00 0.956 0.953 0.951
NODE_12 52901 34.379 1834.21 1802.00 1116.00 639.00 0.960 0.957 0.955
NODE_13 46487 35.145 1254.11 1212.00 662.00 357.00 0.962 0.959 0.956
NODE_14 42066 34.522 2197.40 2195.00 1435.00 818.00 0.960 0.958 0.955
NODE_15 35934 32.807 1004.74 907.00 367.00 171.00 0.951 0.949 0.947
NODE_16 28356 34.240 1324.76 1299.00 733.00 394.00 0.959 0.957 0.954
NODE_17 26026 33.832 1860.52 1819.00 1090.00 648.00 0.957 0.955 0.953
NODE_18 25832 34.821 2181.03 2042.00 1355.00 874.00 0.961 0.958 0.956
NODE_19 24499 35.067 2000.36 2010.00 1252.00 743.00 0.961 0.957 0.954
NODE_20 23272 34.849 1090.49 1014.00 569.00 340.00 0.962 0.958 0.955
NODE_21 21956 34.305 1264.71 1263.00 801.00 463.00 0.961 0.959 0.957
NODE_22 20259 35.283 737.14 750.00 503.00 295.00 0.962 0.959 0.956
NODE_23 19734 33.845 1386.03 1366.00 837.00 400.00 0.954 0.951 0.948
NODE_24 18670 33.476 2175.37 1811.00 1183.00 684.00 0.954 0.951 0.949
NODE_25 16449 38.853 2190.79 2214.00 1434.00 801.00 0.977 0.975 0.972
NODE_26 16232 34.709 1480.97 1486.00 702.00 321.00 0.961 0.959 0.957
NODE_27 13532 34.599 2265.18 2319.00 1572.00 884.00 0.957 0.952 0.948
NODE_28 12209 35.621 2700.38 2847.00 1619.00 717.00 0.965 0.962 0.958
NODE_29 12075 34.791 1381.33 1382.00 982.00 622.00 0.960 0.956 0.952
NODE_30 10228 34.523 2201.04 2059.00 1390.00 884.00 0.959 0.957 0.953
NODE_31 9310 37.787 1678.93 1347.00 840.00 434.00 0.973 0.971 0.968
NODE_32 9224 35.755 2475.87 2501.00 1417.00 830.00 0.966 0.964 0.959
NODE_33 8031 32.611 457.91 415.00 252.00 124.00 0.949 0.946 0.942
NODE_34 7838 34.894 1076.54 976.00 726.00 526.00 0.960 0.957 0.954
NODE_35 7357 33.342 1204.73 1136.00 467.00 144.00 0.953 0.949 0.945
NODE_36 6445 39.472 3057.43 2686.00 2090.00 1546.00 0.971 0.963 0.954
NODE_37 5447 44.924 2366.60 2344.00 2083.00 1893.00 0.991 0.984 0.978
NODE_38 3151 48.969 17347.93 18029.00 16366.00 15164.00 0.982 0.980 0.975
NODE_39 2356 32.598 565.08 592.00 347.00 234.00 0.944 0.940 0.930
NODE_40 2319 43.812 3712.25 3725.00 3417.00 2878.00 0.971 0.927 0.871
NODE_41 2269 34.156 4999.76 5231.00 4312.00 2569.00 0.956 0.951 0.941
NODE_42 1969 48.400 17229.92 17797.00 15229.00 11153.00 0.988 0.984 0.973
NODE_43 1681 41.761 20095.20 21745.00 18287.00 10158.00 0.978 0.967 0.951
NODE_44 1666 42.317 5514.56 5961.00 5026.00 3017.00 0.986 0.981 0.970
NODE_45 1461 32.512 7031.37 8487.00 1585.00 1003.00 0.949 0.942 0.926
NODE_46 1306 31.700 740.65 801.00 362.00 162.00 0.946 0.941 0.926
NODE_47 1301 41.583 4393.83 4412.00 4145.00 3464.00 0.966 0.946 0.921
NODE_48 1194 39.112 3574.48 4156.00 3428.00 716.00 0.977 0.969 0.953
NODE_49 1189 37.426 7669.21 8442.00 7107.00 2700.00 0.972 0.966 0.949
NODE_50 848 38.797 6.27 6.00 5.00 2.00 0.959 0.938 0.891
NODE_51 844 39.455 6.28 6.00 4.00 1.00 0.943 0.931 0.908
NODE_52 657 39.422 5.42 5.00 3.00 2.00 0.938 0.922 0.892
NODE_53 562 35.053 4135.60 5035.00 2381.00 844.00 0.955 0.941 0.904
NODE_54 498 45.382 6505.51 7752.00 4339.00 2186.00 0.969 0.953 0.911
NODE_55 456 48.465 17.98 8.00 2.00 1.00 0.984 0.964 0.919
NODE_56 413 38.499 1.38 1.00 1.00 1.00 0.930 0.913 0.871
NODE_57 409 40.587 3.40 4.00 2.00 1.00 0.965 0.939 0.886
NODE_58 407 38.821 1.72 2.00 1.00 1.00 0.937 0.921 0.884
NODE_59 392 32.398 1021.08 1188.00 743.00 333.00 0.947 0.931 0.884
NODE_60 381 39.108 3.68 2.00 1.00 1.00 0.967 0.946 0.898
NODE_61 379 41.161 66.46 20.00 7.00 2.00 0.980 0.964 0.913
NODE_62 376 37.500 28.62 26.00 16.00 3.00 0.968 0.936 0.880
NODE_63 368 34.511 29.71 15.00 8.00 0.00 0.952 0.923 0.874
NODE_64 354 50.847 85.60 21.00 6.00 5.00 0.983 0.970 0.917
NODE_65 353 37.110 753.38 876.00 469.00 379.00 0.955 0.930 0.870
NODE_66 337 42.136 1.34 1.00 1.00 1.00 0.966 0.951 0.892
NODE_67 336 42.857 6.22 6.00 2.00 0.00 0.979 0.939 0.877
NODE_68 327 54.434 470.35 210.00 10.00 4.00 0.990 0.973 0.906
NODE_69 326 46.933 44.61 49.00 12.00 7.00 0.969 0.954 0.902
NODE_70 326 53.067 12.85 16.00 3.00 1.00 0.990 0.971 0.914
NODE_71 325 38.462 1.81 2.00 1.00 1.00 0.933 0.919 0.875
NODE_72 315 41.270 688.01 713.00 624.00 335.00 0.954 0.927 0.871
NODE_73 315 36.508 1.90 2.00 1.00 1.00 0.897 0.879 0.828
NODE_74 313 40.575 2966.10 3041.00 1420.00 679.00 0.954 0.929 0.875
NODE_75 311 42.444 519.19 424.00 121.00 5.00 0.968 0.931 0.865
NODE_76 307 41.694 14473.75 14135.00 5771.00 2266.00 0.959 0.919 0.847
NODE_77 306 50.327 19.62 17.00 3.00 2.00 0.982 0.963 0.901
NODE_78 305 44.262 7.70 7.00 1.00 1.00 0.972 0.954 0.898
NODE_79 304 46.711 10.71 7.00 1.00 0.00 0.970 0.942 0.883
NODE_80 301 38.870 7.26 8.00 7.00 2.00 0.959 0.931 0.867
NODE_81 298 33.893 25.34 18.00 13.00 5.00 0.936 0.914 0.855
NODE_82 298 35.235 9.32 6.00 2.00 1.00 0.960 0.926 0.865
NODE_83 297 49.158 1.02 1.00 1.00 1.00 0.971 0.952 0.887
NODE_84 294 55.442 1.52 1.00 1.00 1.00 0.985 0.968 0.909
NODE_85 294 46.939 1.54 2.00 1.00 1.00 0.977 0.950 0.885
NODE_86 293 43.345 7943.56 8959.00 3320.00 1435.00 0.967 0.926 0.859
NODE_87 293 49.829 14.19 10.00 7.00 4.00 0.986 0.971 0.907
NODE_88 293 46.758 8.60 3.00 1.00 0.00 0.983 0.966 0.903
NODE_89 292 45.548 2.07 2.00 2.00 2.00 0.988 0.967 0.895
NODE_90 292 46.918 7.93 4.00 1.00 1.00 0.980 0.956 0.885
NODE_91 291 34.021 5.95 6.00 1.00 0.00 0.950 0.901 0.837
NODE_92 290 41.379 6.68 5.00 2.00 1.00 0.955 0.913 0.851
NODE_93 290 41.724 68.56 51.00 16.00 12.00 0.960 0.928 0.864
NODE_94 287 44.251 8.97 11.00 3.00 1.00 0.966 0.931 0.864
NODE_95 287 41.812 78.16 14.00 12.00 7.00 0.972 0.941 0.883
NODE_96 287 31.707 2.38 2.00 2.00 2.00 0.888 0.868 0.816
NODE_97 287 37.282 3.01 3.00 2.00 1.00 0.924 0.904 0.853
NODE_98 286 39.510 2140.09 2266.00 1187.00 710.00 0.964 0.939 0.866
NODE_99 286 44.406 37.02 38.00 15.00 9.00 0.970 0.927 0.860
NODE_100 283 51.943 2.13 2.00 2.00 2.00 0.955 0.921 0.855
NODE_101 281 56.228 19.95 23.00 11.00 1.00 0.985 0.963 0.903
NODE_102 281 31.317 9.78 8.00 7.00 5.00 0.919 0.896 0.841
NODE_103 281 30.961 2.14 2.00 1.00 1.00 0.866 0.796 0.728
NODE_104 281 43.060 75.62 33.00 23.00 13.00 0.961 0.928 0.860
NODE_105 280 45.000 1.07 1.00 1.00 1.00 0.976 0.955 0.885
NODE_106 271 44.649 10100.45 10856.00 5730.00 2848.00 0.962 0.922 0.855
NODE_107 267 42.697 3611.71 3694.00 2046.00 1091.00 0.938 0.912 0.850
NODE_108 255 40.784 2437.40 2426.00 1601.00 776.00 0.950 0.916 0.853
NODE_109 223 43.498 17778.34 19280.00 8271.00 4438.00 0.959 0.915 0.841
NODE_110 216 41.667 1358.76 1434.00 817.00 425.00 0.940 0.899 0.829
NODE_111 211 41.232 1140.87 1287.00 630.00 313.00 0.954 0.916 0.846
NODE_112 197 42.640 15638.01 16852.00 8738.00 4369.00 0.966 0.919 0.835
NODE_113 192 44.271 17750.68 21036.00 11652.00 6118.00 0.951 0.905 0.826
NODE_114 185 42.162 1611.31 1935.00 1052.00 440.00 0.958 0.922 0.836
NODE_115 171 40.351 278.75 313.00 173.00 65.00 0.925 0.869 0.790
NODE_116 166 43.373 2173.89 2479.00 1976.00 1009.00 0.967 0.913 0.817
NODE_117 142 40.845 121.27 125.00 115.00 88.00 0.966 0.879 0.782
NODE_118 128 100.000 3778.66 3726.00 3475.00 3062.00 0.000 0.000 0.000
NODE_119 128 30.469 19.09 20.00 18.00 16.00 0.920 0.870 0.781

Table 4. Basic scaffold statistics for example Download table data

#ID length GC coverage C50 C75 C90 S_2mer S_3mer S_4mer
NODE_1 182623 33.467 684.59 646.00 371.00 181.00 0.956 0.954 0.952
NODE_2 178351 34.587 1253.42 1237.00 765.00 442.00 0.959 0.956 0.953
NODE_3 168600 34.098 1914.56 1841.00 1159.00 613.00 0.958 0.955 0.953
NODE_4 133226 35.728 2681.58 2214.00 1341.00 739.00 0.972 0.967 0.963
NODE_5 108610 33.987 1071.17 1032.00 588.00 305.00 0.955 0.953 0.950
NODE_6 104422 34.860 1578.88 1564.00 872.00 468.00 0.961 0.958 0.955
NODE_7 98522 34.342 1482.21 1444.00 816.00 445.00 0.958 0.956 0.954
NODE_8 92742 35.171 1287.58 1280.00 807.00 467.00 0.962 0.959 0.956
NODE_9 70410 34.789 1079.93 1066.00 675.00 382.00 0.959 0.956 0.952
NODE_10 65210 34.559 1995.08 1893.00 1164.00 644.00 0.964 0.960 0.957
NODE_11 57454 34.495 788.27 782.00 472.00 271.00 0.958 0.955 0.952
NODE_12 56714 33.849 1357.29 1297.00 751.00 411.00 0.956 0.953 0.951
NODE_13 46487 35.145 1254.12 1212.00 662.00 357.00 0.962 0.959 0.956
NODE_14 42066 34.522 2197.39 2195.00 1435.00 818.00 0.960 0.958 0.955
NODE_15 35934 32.807 1004.74 907.00 367.00 171.00 0.951 0.949 0.947
NODE_16 28356 34.240 1324.76 1299.00 733.00 394.00 0.959 0.957 0.954
NODE_17 26026 33.832 1860.52 1819.00 1090.00 648.00 0.957 0.955 0.953
NODE_18 25832 34.821 2181.03 2042.00 1355.00 874.00 0.961 0.958 0.956
NODE_19 24499 35.067 2000.36 2010.00 1252.00 743.00 0.961 0.957 0.954
NODE_20 23272 34.849 1090.49 1014.00 569.00 340.00 0.962 0.958 0.955
NODE_21 21956 34.305 1264.71 1263.00 801.00 463.00 0.961 0.959 0.957
NODE_22 20259 35.283 737.13 750.00 503.00 295.00 0.962 0.959 0.956
NODE_23 19734 33.845 1386.08 1366.00 837.00 400.00 0.954 0.951 0.948
NODE_24 18670 33.476 2175.37 1811.00 1183.00 684.00 0.954 0.951 0.949
NODE_25 16232 34.709 1480.97 1486.00 702.00 321.00 0.961 0.959 0.957
NODE_26 13532 34.599 2265.18 2319.00 1572.00 884.00 0.957 0.952 0.948
NODE_27 12075 34.791 1381.32 1382.00 982.00 622.00 0.960 0.956 0.952
NODE_28 10228 34.523 2201.04 2059.00 1390.00 884.00 0.959 0.957 0.953
NODE_29 9310 37.787 1678.93 1347.00 840.00 434.00 0.973 0.971 0.968
NODE_30 9224 35.755 2475.87 2501.00 1417.00 830.00 0.966 0.964 0.959
NODE_31 8031 32.611 457.91 415.00 252.00 124.00 0.949 0.946 0.942
NODE_32 7838 34.894 1076.54 976.00 726.00 526.00 0.960 0.957 0.954
NODE_33 7357 33.342 1204.73 1136.00 467.00 144.00 0.953 0.949 0.945
NODE_34 5447 44.924 2366.60 2344.00 2083.00 1893.00 0.991 0.984 0.978
NODE_35 5220 47.816 16992.86 17913.00 16053.00 11899.00 1.001 0.988 0.978
NODE_36 2356 32.598 565.08 592.00 347.00 234.00 0.944 0.940 0.930
NODE_37 2269 34.156 4999.76 5231.00 4312.00 2569.00 0.956 0.951 0.941
NODE_38 1681 41.761 20094.71 21745.00 18287.00 10150.00 0.978 0.967 0.951
NODE_39 1666 42.317 5514.56 5961.00 5026.00 3017.00 0.986 0.981 0.970
NODE_40 1461 32.512 7031.37 8487.00 1585.00 1003.00 0.949 0.942 0.926
NODE_41 1306 31.700 740.65 801.00 362.00 162.00 0.946 0.941 0.926
NODE_42 1194 39.112 3574.48 4156.00 3428.00 716.00 0.977 0.969 0.953
NODE_43 1189 37.426 7669.21 8442.00 7107.00 2700.00 0.972 0.966 0.949
NODE_44 848 38.797 6.27 6.00 5.00 2.00 0.959 0.938 0.891
NODE_45 844 39.455 6.28 6.00 4.00 1.00 0.943 0.931 0.908
NODE_46 657 39.422 5.42 5.00 3.00 2.00 0.938 0.922 0.892
NODE_47 562 35.053 4135.60 5035.00 2381.00 844.00 0.955 0.941 0.904
NODE_48 498 45.382 6439.95 7752.00 4163.00 2011.00 0.969 0.953 0.911
NODE_49 456 48.465 17.98 8.00 2.00 1.00 0.984 0.964 0.919
NODE_50 413 38.499 1.38 1.00 1.00 1.00 0.930 0.913 0.871
NODE_51 409 40.587 3.40 4.00 2.00 1.00 0.965 0.939 0.886
NODE_52 407 38.821 1.72 2.00 1.00 1.00 0.937 0.921 0.884
NODE_53 392 32.398 1021.08 1188.00 743.00 333.00 0.947 0.931 0.884
NODE_54 381 39.108 3.68 2.00 1.00 1.00 0.967 0.946 0.898
NODE_55 379 41.161 66.46 20.00 7.00 2.00 0.980 0.964 0.913
NODE_56 376 37.500 28.62 26.00 16.00 3.00 0.968 0.936 0.880
NODE_57 368 34.511 29.71 15.00 8.00 0.00 0.952 0.923 0.874
NODE_58 354 50.847 85.60 21.00 6.00 5.00 0.983 0.970 0.917
NODE_59 353 37.110 753.38 876.00 469.00 379.00 0.955 0.930 0.870
NODE_60 337 42.136 1.34 1.00 1.00 1.00 0.966 0.951 0.892
NODE_61 336 42.857 5.68 6.00 2.00 0.00 0.979 0.939 0.877
NODE_62 327 54.434 421.56 195.00 9.00 3.00 0.990 0.973 0.906
NODE_63 326 46.933 40.38 45.00 11.00 6.00 0.969 0.954 0.902
NODE_64 326 53.067 12.85 16.00 3.00 1.00 0.990 0.971 0.914
NODE_65 325 38.462 1.81 2.00 1.00 1.00 0.933 0.919 0.875
NODE_66 315 41.270 684.80 710.00 622.00 335.00 0.954 0.927 0.871
NODE_67 315 36.508 1.90 2.00 1.00 1.00 0.897 0.879 0.828
NODE_68 313 40.575 2784.46 2816.00 1334.00 633.00 0.954 0.929 0.875
NODE_69 311 42.444 491.38 423.00 94.00 5.00 0.968 0.931 0.865
NODE_70 307 41.694 14326.13 14060.00 5774.00 2260.00 0.959 0.919 0.847
NODE_71 306 50.327 19.62 17.00 3.00 2.00 0.982 0.963 0.901
NODE_72 305 44.262 7.70 7.00 1.00 1.00 0.972 0.954 0.898
NODE_73 304 46.711 10.71 7.00 1.00 0.00 0.970 0.942 0.883
NODE_74 301 38.870 7.26 8.00 7.00 2.00 0.959 0.931 0.867
NODE_75 298 33.893 25.91 18.00 13.00 5.00 0.936 0.914 0.855
NODE_76 298 35.235 9.32 6.00 2.00 1.00 0.960 0.926 0.865
NODE_77 297 49.158 1.02 1.00 1.00 1.00 0.971 0.952 0.887
NODE_78 294 55.442 1.52 1.00 1.00 1.00 0.985 0.968 0.909
NODE_79 294 46.939 1.54 2.00 1.00 1.00 0.977 0.950 0.885
NODE_80 293 43.345 7897.85 8942.00 3297.00 1413.00 0.967 0.926 0.859
NODE_81 293 49.829 14.19 10.00 7.00 4.00 0.986 0.971 0.907
NODE_82 293 46.758 8.60 3.00 1.00 0.00 0.983 0.966 0.903
NODE_83 292 45.548 2.07 2.00 2.00 2.00 0.988 0.967 0.895
NODE_84 292 46.918 3.16 4.00 1.00 1.00 0.980 0.956 0.885
NODE_85 291 34.021 3.71 4.00 1.00 0.00 0.950 0.901 0.837
NODE_86 290 41.379 6.68 5.00 2.00 1.00 0.955 0.913 0.851
NODE_87 290 41.724 66.89 50.00 14.00 10.00 0.960 0.928 0.864
NODE_88 287 44.251 8.97 11.00 3.00 1.00 0.966 0.931 0.864
NODE_89 287 41.812 78.16 14.00 12.00 7.00 0.972 0.941 0.883
NODE_90 287 31.707 2.38 2.00 2.00 2.00 0.888 0.868 0.816
NODE_91 287 37.282 3.01 3.00 2.00 1.00 0.924 0.904 0.853
NODE_92 286 39.510 2140.09 2266.00 1187.00 710.00 0.964 0.939 0.866
NODE_93 286 44.406 36.46 38.00 14.00 8.00 0.970 0.927 0.860
NODE_94 283 51.943 2.13 2.00 2.00 2.00 0.955 0.921 0.855
NODE_95 281 56.228 19.95 23.00 11.00 1.00 0.985 0.963 0.903
NODE_96 281 31.317 9.78 8.00 7.00 5.00 0.919 0.896 0.841
NODE_97 281 30.961 2.14 2.00 1.00 1.00 0.866 0.796 0.728
NODE_98 281 43.060 29.21 26.00 16.00 8.00 0.961 0.928 0.860
NODE_99 280 45.000 1.07 1.00 1.00 1.00 0.976 0.955 0.885
NODE_100 271 44.649 10070.13 10850.00 5719.00 2844.00 0.962 0.922 0.855
NODE_101 267 42.697 3375.30 3476.00 1820.00 872.00 0.938 0.912 0.850
NODE_102 255 40.784 2399.00 2405.00 1543.00 776.00 0.950 0.916 0.853
NODE_103 223 43.498 17720.84 19196.00 8262.00 4395.00 0.959 0.915 0.841
NODE_104 216 41.667 1312.00 1374.00 761.00 423.00 0.940 0.899 0.829
NODE_105 211 41.232 1142.41 1290.00 631.00 313.00 0.954 0.916 0.846
NODE_106 197 42.640 15573.62 16793.00 8736.00 4358.00 0.966 0.919 0.835
NODE_107 192 44.271 17683.44 20988.00 11641.00 6096.00 0.951 0.905 0.826
NODE_108 185 42.162 1536.76 1850.00 989.00 411.00 0.958 0.922 0.836
NODE_109 171 40.351 275.58 315.00 169.00 66.00 0.925 0.869 0.790
NODE_110 166 43.373 2126.71 2422.00 1972.00 1003.00 0.967 0.913 0.817
NODE_111 142 40.845 105.83 113.00 93.00 72.00 0.966 0.879 0.782
NODE_112 128 100.000 3773.05 3725.00 3472.00 3061.00 0.000 0.000 0.000
NODE_113 128 30.469 19.09 20.00 18.00 16.00 0.920 0.870 0.781

Details

Method: Bakta

Rapid & standardized annotation of bacterial genomes, MAGs & plasmids.

Custom Parameters
  • --force

TablesReturn to top

Table 1. Annotation details Download table data

Sample tRNAs tmRNAs rRNAs ncRNAs ncRNA regions CRISPR arrays CDSs pseudogenes hypotheticals signal peptides sORFs gaps oriCs oriVs oriTs
example 52 1 6 10 24 0 1720 20 102 0 4 0 3 0 1

Citations